'Unusual writing error in fastq file: header move to 4th line i.e. quality score value line
I have transcriptome sequencing data but there is a problem during sequence writing.
Now the sequencing data looks like this:
Normally the data should look like (4 line format):
@HWI-1KL133:1:1101:3288:2194#0/1 [header- first line]
CTGCCCAAAAACTCCTTCTTCTCCGAGTTCCAGATGAATTTTTTCCAGCTG [sequence- second line]
+ [ "+" sign - third line]
Y^^]cccRbc^cWY^aacedhXJbPHWP_^ca^[^Ia^XacIY_R^^cBBB [quality values - fourth line]
@HWI-1KL133:1:1101:3567:2197#0/1
GCAGGGTTTAGGAAGTTGTTCACATTGGGGCTTGGCAGTTGTTGAGAAGGA
+
_b_eeecdgggggiiegiiiihiiiihiiiiiiiiaghgfhhiidhfhhhe
But in my case it is looking like this:
@HWI-1KL133:1:1101:3288:2194#0/1
CTGCCCAAAAACTCCTTCTTCTCCGAGTTCCAGATGAATTTTTTCCAGCTG
+
Y^^]cccRbc^cWY^aacedhXJbPHWP_^ca^[^Ia^XacIY_R^^cBBB@HWI-1KL133:1:1101:3567:2197#0/1
GCAGGGTTTAGGAAGTTGTTCACATTGGGGCTTGGCAGTTGTTGAGAAGGA
+
_b_eeecdgggggiiegiiiihiiiihiiiiiiiiaghgfhhiidhfhhhe
Here, you can see that for the first sequence the format of fastq is maintained but for the second sequence the header line i.e. started with @HWI-1KL133:1:1101:3567:2197#0/1 was merged with the fourth line of the first sequence.
I want to remove the unusual header from the 4th line and put it into the upcoming header line (1st line of the next or second sequence).
I request you to please provide possible solution.
Sources
This article follows the attribution requirements of Stack Overflow and is licensed under CC BY-SA 3.0.
Source: Stack Overflow
| Solution | Source |
|---|
