'Which machine learning methods can I use to predict DNA Sequences?
I have a dataset of DNA Sequences related to Covid-19 and I simply want to predict possible future sequences based on the existing sequences.
DNA Sequences are consist of 4 letters and 4 letters only, A,G,T and C. So a chunk of a sequence would look like
"ATGGAGAGCCTTGTCCCTGGTTTCAACGAGAA"
Any advice or help regarding how to predict future mutations based on these existing data would be a lot of help.
Sources
This article follows the attribution requirements of Stack Overflow and is licensed under CC BY-SA 3.0.
Source: Stack Overflow
| Solution | Source |
|---|